ZFIN ID: ZDB-MRPHLNO-120130-1
Morpholino Name: MO1-jam2a
Target: jam2a (1)
Sequence:
5' - GCACACCAGCATTTTCTCCACAGTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-jam2a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-jam2a
Expressed Gene Anatomy Figures
desma Fig. 3 from Kobayashi et al., 2014
efnb2a Fig. 3 from Kobayashi et al., 2014
fli1 Fig. 3 from Kobayashi et al., 2014
runx1 Fig. 3Fig. S7 from Kobayashi et al., 2014
PHENOTYPE
Phenotype resulting from MO1-jam2a
Phenotype of all Fish created by or utilizing MO1-jam2a
Genome Resources:
CITATIONS (3)