header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-120103-2
Morpholino Name: MO2-colec12
Target: colec12 (1)
Previous Names: zCL-P1 MO 2 (1), MO2-si:ch211-212m21.5 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GCACCGTTCCGTCACGAGCCAAACC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO, targets the 5'UTR.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-colec12 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-colec12 No data available
PHENOTYPE
Phenotype resulting from MO2-colec12
Phenotype of all Fish created by or utilizing MO2-colec12
OTHER MO2-colec12 MORPHOLINO PAGESNo links to external sites
CITATIONS (2)