Morpholino

MO2-irf8

ID
ZDB-MRPHLNO-111212-3
Name
MO2-irf8
Previous Names
  • irf8 MOatg (1)
Target
Sequence
5' - TCAGTCTGCGACCGCCCGAGTTCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-irf8
Phenotype
Phenotype resulting from MO2-irf8
Phenotype of all Fish created by or utilizing MO2-irf8
Phenotype Fish Conditions Figures
macrophage decreased amount, abnormal TU + MO2-irf8 standard conditions Fig. S8 from He et al., 2015
neutrophil increased amount, abnormal TU + MO2-irf8 standard conditions Fig. S8 from He et al., 2015
macrophage decreased amount, abnormal WT + MO2-irf8 standard conditions Fig. 7 from Prajsnar et al., 2012
neutrophil increased amount, abnormal WT + MO2-irf8 standard conditions Fig. 7 from Prajsnar et al., 2012
brain vasculature wound healing decreased occurrence, abnormal cq10Tg; hkz04tTg; nz50Tg + MO2-irf8 light ablation: brain vasculature, chemical treatment by environment: nocodazole Fig. 6 from Liu et al., 2016
brain vasculature wound healing decreased efficacy, abnormal cq10Tg; hkz04tTg; nz50Tg + MO2-irf8 light ablation: brain vasculature Fig. 6 from Liu et al., 2016
brain vasculature wound healing process efficacy, ameliorated cq10Tg; hkz04tTg; nz50Tg + MO2-irf8 light ablation: brain vasculature, chemical treatment by environment: NSC 23766 Fig. 7 from Liu et al., 2016
brain vasculature wound healing increased duration, abnormal cq10Tg; hkz04tTg; nz50Tg + MO2-irf8 light ablation: brain vasculature Fig. 6 from Liu et al., 2016
brain vasculature wound healing duration, ameliorated cq10Tg; hkz04tTg; nz50Tg + MO2-irf8 light ablation: brain vasculature, chemical treatment by environment: NSC 23766 Fig. 7 from Liu et al., 2016
regenerating tissue endothelial cell RaichuEV expression decreased amount, abnormal cq17Tg; hkz04tTg + MO2-irf8 light ablation: brain vasculature Fig. 7 from Liu et al., 2016
brain vasculature wound healing duration, ameliorated cq21Tg; hkz04tTg; nz50Tg + MO2-irf8 light ablation: brain vasculature Fig. 7 from Liu et al., 2016
brain vasculature wound healing process efficacy, ameliorated cq21Tg; hkz04tTg; nz50Tg + MO2-irf8 light ablation: brain vasculature Fig. 7 from Liu et al., 2016
defense response to fungus increased efficacy, abnormal gl23Tg; i113Tg + MO2-irf8 fungal treatment by injection: Talaromyces marneffei Fig. 5 with image from Ellett et al., 2018
macrophage decreased amount, abnormal gl23Tg; i113Tg + MO2-irf8 control Fig. 5 with image from Ellett et al., 2018
neutrophil increased amount, abnormal gl23Tg; i113Tg + MO2-irf8 control Fig. 5 with image from Ellett et al., 2018
defense response to fungus increased efficacy, abnormal mpxgl8/gl8; gl23Tg; i113Tg + MO2-irf8 fungal treatment by injection: Talaromyces marneffei Fig. 5 with image from Ellett et al., 2018
Citations