ZFIN ID: ZDB-MRPHLNO-111103-4
Morpholino Name: MO1-carm1
Target: carm1 (1)
Sequence:
5' - GAGAACACGGACACCGCCATCTTCG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-carm1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-carm1
Expressed Gene Anatomy Figures
carm1 Fig. 2 with image from Batut et al., 2011
mef2ca Fig. 3 with image from Batut et al., 2011
myf5 Fig. 3 with image from Batut et al., 2011
myod1 Fig. 3 with image from Batut et al., 2011
myog Fig. 3 with image from Batut et al., 2011
PHENOTYPE
Phenotype resulting from MO1-carm1
Phenotype of all Fish created by or utilizing MO1-carm1
Genome Resources:
CITATIONS (2)