ZFIN ID: ZDB-MRPHLNO-111027-1
Morpholino Name: MO4-shhb
Target: shhb (1)
Sequence:
5' - TTCCATGACGTTTGAATTATCTCTT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO. The first nucleotide is a mismatch.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO4-shhb No data available
GENE EXPRESSION
Gene expression in Wild Types + MO4-shhb No data available
PHENOTYPE
Phenotype resulting from MO4-shhb
No data available

Phenotype of all Fish created by or utilizing MO4-shhb
Genome Resources:
CITATIONS (1)