ZFIN ID: ZDB-MRPHLNO-111004-5
Morpholino Name: MO1-tshr
Target: tshr (1)
Sequence:
5' - ATGTAGGCTATTTTCTTCCACACGA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Targets the 5'UTR.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-tshr No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-tshr
Expressed Gene Anatomy Figures
bcl2l1 Fig. 9 from Opitz et al., 2011
nkx2.4b Fig. 9 from Opitz et al., 2011
pax8 Fig. 9 from Opitz et al., 2011
slc5a5 Fig. 9 from Opitz et al., 2011
tg Fig. 7Fig. 9 from Opitz et al., 2011
PHENOTYPE
Phenotype resulting from MO1-tshr
Phenotype of all Fish created by or utilizing MO1-tshr
Genome Resources:
CITATIONS (1)