Morpholino

MO2-lin28a

ID
ZDB-MRPHLNO-110913-2
Name
MO2-lin28a
Previous Names
None
Target
Sequence
5' - ACTAGGCCATACAATTAACTGCTTT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Targets the 5'UTR.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-lin28a
No data available
Phenotype
Phenotype resulting from MO2-lin28a
No data available
Phenotype of all Fish created by or utilizing MO2-lin28a
No data available
Citations