header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-110913-1
Morpholino Name: MO1-lin28a
Target: lin28a (1)
Sequence:
5' - GGGCATCTTTATGATTTAGCCTTCT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-lin28a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-lin28a No data available
PHENOTYPE
Phenotype resulting from MO1-lin28a
Phenotype of all Fish created by or utilizing MO1-lin28a
OTHER MO1-lin28a MORPHOLINO PAGESNo links to external sites
CITATIONS (4)