Community Action Needed: Please respond to the NIH RFI
Morpholino

MO1-lims2

ID
ZDB-MRPHLNO-110907-6
Name
MO1-lims2
Previous Names
  • MO2-pinch2 (1)
Target
Sequence
5' - GAGCTTCTGCTTCTGCTTCCATCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-lims2
Expressed Gene Anatomy Figures
ilk Fig. 7 from Meder et al., 2011
Phenotype
Phenotype resulting from MO1-lims2
Phenotype of all Fish created by or utilizing MO1-lims2
Citations