header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-110907-4
Morpholino Name: MO1-lims1
Target: lims1 (1)
Previous Name: MO1-pinch1 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CGCTGCTCTACTGACCCGCAGTTGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-lims1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-lims1
Expressed Gene Anatomy Figures
ilk Fig. 7 from Meder et al., 2011
nppa Fig. 9 from Meder et al., 2011
PHENOTYPE
Phenotype resulting from MO1-lims1
Phenotype of all Fish created by or utilizing MO1-lims1
OTHER MO1-lims1 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)