ZFIN ID: ZDB-MRPHLNO-110802-5
Morpholino Name: MO1-oxt
Target: oxt (1)
Previous Name: MO1-oxtl

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GACAGCAGACCTCCAGACATTATTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-oxt No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-oxt
Expressed Gene Anatomy Figures
atp1b1b Fig. 3 from Chou et al., 2011
atp6v1aa Fig. 3 from Chou et al., 2011
foxi3a Fig. 5 from Chou et al., 2011
slc9a3.2 Fig. 3 from Chou et al., 2011
slc12a10.2 Fig. 3 from Chou et al., 2011
tp63 Fig. 6 from Chou et al., 2011
trpv6 Fig. 3 from Chou et al., 2011
PHENOTYPE
Phenotype resulting from MO1-oxt
Phenotype of all Fish created by or utilizing MO1-oxt
Genome Resources:
CITATIONS (1)