ZFIN ID: ZDB-MRPHLNO-110711-1
Morpholino Name: MO1-fscn2b
Target: fscn2b (1)
Previous Name: f2b-AUG (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CTTTGCTGCCATTGGAGGGCATCCT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-fscn2b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-fscn2b No data available
PHENOTYPE
Phenotype resulting from MO1-fscn2b
No data available

Phenotype of all Fish created by or utilizing MO1-fscn2b
No data available
OTHER MO1-fscn2b MORPHOLINO PAGESNo links to external sites
CITATIONS (1)