header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-110628-3
Morpholino Name: MO2-slit3
Target: slit3 (1)
Previous Name: slit3 ATG (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CCCCCAATACTTTACCCACCGCATC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
View all 3 target locations
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-slit3 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-slit3 No data available
PHENOTYPE
Phenotype resulting from MO2-slit3
No data available

Phenotype of all Fish created by or utilizing MO2-slit3
No data available
Genome Resources:
CITATIONS (1)