ZFIN ID: ZDB-MRPHLNO-110614-3
Morpholino Name: MO3-nf1a
Target: nf1a (1)
Previous Name: nf1a-e7 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TAGTAAACAAGTGTCACTCACCGGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-nf1a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-nf1a No data available
PHENOTYPE
Phenotype resulting from MO3-nf1a
No data available

Phenotype of all Fish created by or utilizing MO3-nf1a
Phenotype Fish Conditions Figures
neuron positive regulation of ERK1 and ERK2 cascade increased occurrence, abnormal tp53zdf1/zdf1; vu12Tg + MO2-nf1b + MO3-nf1a standard conditions Fig. 6 from Lee et al., 2010
oligodendrocyte increased amount, abnormal tp53zdf1/zdf1; vu12Tg + MO2-nf1b + MO3-nf1a standard conditions Fig. 1 from Lee et al., 2010
oligodendrocyte cell migration increased occurrence, abnormal tp53zdf1/zdf1; vu12Tg + MO2-nf1b + MO3-nf1a standard conditions Fig. 5 from Lee et al., 2010
oligodendrocyte cell migration increased process quality, abnormal tp53zdf1/zdf1; vu12Tg + MO2-nf1b + MO3-nf1a standard conditions Fig. 5 from Lee et al., 2010
oligodendrocyte progenitor proliferation increased occurrence, abnormal tp53zdf1/zdf1; vu12Tg + MO2-nf1b + MO3-nf1a standard conditions Fig. 3 from Lee et al., 2010
OTHER MO3-nf1a MORPHOLINO PAGESNo links to external sites
CITATIONS (1)