header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-110405-2
Morpholino Name: MO3-myb
Target: myb (1)
Previous Names: MO3-cmyb, c-myb-TPmiR126 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TGTACCACGAGTGTAGGGACTGTTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: This Morpholino acts as a target protector by competing with miR126 for the specific target sequence in the 3'UTR of cmyb.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-myb No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-myb
Expressed Gene Anatomy Figures
mpl Fig. 4 from Grabher et al., 2011
myb Fig. 3 from Grabher et al., 2011
slc4a1a Fig. 4 from Grabher et al., 2011
PHENOTYPE
Phenotype resulting from MO3-myb
Phenotype of all Fish created by or utilizing MO3-myb
OTHER MO3-myb MORPHOLINO PAGES No links to external sites
CITATIONS (1)