ZFIN ID: ZDB-MRPHLNO-110304-7
Morpholino Name: MO2-arr3a
Target: arr3a (1)
Previous Name: MO2-arr3l

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TCTTCTTGTAAACTTTGTCAGCCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-arr3a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-arr3a
Expressed Gene Anatomy Figures
arr3a Fig. 7 from Ile et al., 2010
pitpnb Fig. 7 from Ile et al., 2010
PHENOTYPE
Phenotype resulting from MO2-arr3a
No data available

Phenotype of all Fish created by or utilizing MO2-arr3a
No data available
OTHER MO2-arr3a MORPHOLINO PAGESNo links to external sites
CITATIONS (1)