ZFIN ID: ZDB-MRPHLNO-110223-3
Morpholino Name: MO6-mpp5a
Target: mpp5a (1)
Sequence:
5' - GAGCCACACCCGTGTTTGCCAGTCA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO6-mpp5a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO6-mpp5a No data available
PHENOTYPE
Phenotype resulting from MO6-mpp5a
Phenotype Figures
dorsal motor nucleus of vagus nerve development disrupted, abnormal Fig. 2 with image from Ohata et al., 2011
dorsolateral motor nucleus of vagal nerve malformed, abnormal Fig. 2 with image from Ohata et al., 2011
motor neuron precursor migration involved in dorsal motor nucleus of vagus nerve formation disrupted, abnormal Fig. 2 with image from Ohata et al., 2011
vagal ganglion fused with vagal ganglion, abnormal Fig. 2 with image from Ohata et al., 2011

Phenotype of all Fish created by or utilizing MO6-mpp5a
Phenotype Fish Conditions Figures
vagal ganglion fused with vagal ganglion, abnormal rw0Tg + MO6-mpp5a standard conditions Fig. 2 with image from Ohata et al., 2011
dorsal motor nucleus of vagus nerve development disrupted, abnormal rw0Tg + MO6-mpp5a standard conditions Fig. 2 with image from Ohata et al., 2011
motor neuron precursor migration involved in dorsal motor nucleus of vagus nerve formation disrupted, abnormal rw0Tg + MO6-mpp5a standard conditions Fig. 2 with image from Ohata et al., 2011
dorsolateral motor nucleus of vagal nerve malformed, abnormal rw0Tg + MO6-mpp5a standard conditions Fig. 2 with image from Ohata et al., 2011
OTHER MO6-mpp5a MORPHOLINO PAGESNo links to external sites
CITATIONS (2)