Morpholino

MO1-git2a

ID

ZDB-MRPHLNO-110126-3

Name

MO1-git2a

Previous Names

None

Target

Sequence

5' - CTGAACCATCTGTGAATGAGAAAGA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO. Targets the intron 2–exon 3 splice acceptor site.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-git2a

No data available

Phenotype

Phenotype resulting from MO1-git2a

Phenotype	Fish	Figures
cell migration involved in gastrulation decreased rate, abnormal	AB + MO1-git2a	Fig. 3 from Yu et al., 2011
cell migration involved in gastrulation disrupted, abnormal	AB + MO1-git2a	Fig. 3 from Yu et al., 2011
cell migration involved in gastrulation process quality, abnormal	AB + MO1-git2a	Fig. 3 from Yu et al., 2011
embryo development delayed, abnormal	AB + MO1-git2a	Fig. 2 from Yu et al., 2011
embryo development disrupted, abnormal	AB + MO1-git2a	Fig. 2 from Yu et al., 2011
epiboly involved in gastrulation with mouth forming second disrupted, abnormal	AB + MO1-git2a	Fig. 2 , Fig. 3 from Yu et al., 2011
EVL cell morphology, abnormal	AB + MO1-git2a	Fig. 4 , Fig. 6 from Yu et al., 2011
margin constricted, abnormal	AB + MO1-git2a	Fig. 2 from Yu et al., 2011
post-vent region kinked, abnormal	AB + MO1-git2a	Fig. 2 from Yu et al., 2011
whole organism decreased length, abnormal	AB + MO1-git2a	Fig. 2 from Yu et al., 2011
whole organism edematous, abnormal	AB + MO1-git2a	Fig. 2 from Yu et al., 2011
whole organism viability, abnormal	AB + MO1-git2a	Fig. 2 from Yu et al., 2011

Phenotype of all Fish created by or utilizing MO1-git2a

Phenotype	Fish	Conditions	Figures
margin constricted, abnormal	AB + MO1-git2a	standard conditions	Fig. 2 from Yu et al., 2011
whole organism edematous, abnormal	AB + MO1-git2a	standard conditions	Fig. 2 from Yu et al., 2011
post-vent region kinked, abnormal	AB + MO1-git2a	standard conditions	Fig. 2 from Yu et al., 2011
whole organism decreased length, abnormal	AB + MO1-git2a	standard conditions	Fig. 2 from Yu et al., 2011
embryo development disrupted, abnormal	AB + MO1-git2a	standard conditions	Fig. 2 from Yu et al., 2011
whole organism viability, abnormal	AB + MO1-git2a	standard conditions	Fig. 2 from Yu et al., 2011
EVL cell morphology, abnormal	AB + MO1-git2a	standard conditions	Fig. 4 , Fig. 6 from Yu et al., 2011
epiboly involved in gastrulation with mouth forming second disrupted, abnormal	AB + MO1-git2a	standard conditions	Fig. 2 , Fig. 3 from Yu et al., 2011
cell migration involved in gastrulation decreased rate, abnormal	AB + MO1-git2a	standard conditions	Fig. 3 from Yu et al., 2011
cell migration involved in gastrulation disrupted, abnormal	AB + MO1-git2a	standard conditions	Fig. 3 from Yu et al., 2011
cell migration involved in gastrulation process quality, abnormal	AB + MO1-git2a	standard conditions	Fig. 3 from Yu et al., 2011
embryo development delayed, abnormal	AB + MO1-git2a	standard conditions	Fig. 2 from Yu et al., 2011

Citations