ZFIN ID: ZDB-MRPHLNO-110126-3
Morpholino Name: MO1-git2a
Target: git2a (1)
Sequence:
5' - CTGAACCATCTGTGAATGAGAAAGA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO. Targets the intron 2–exon 3 splice acceptor site.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-git2a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-git2a No data available
PHENOTYPE
Phenotype resulting from MO1-git2a
Phenotype Figures
cell migration involved in gastrulation decreased rate, abnormal Fig. 3 with image from Yu et al., 2011
cell migration involved in gastrulation disrupted, abnormal Fig. 3 with image from Yu et al., 2011
cell migration involved in gastrulation process quality, abnormal Fig. 3 with image from Yu et al., 2011
embryo development delayed, abnormal Fig. 2 with image from Yu et al., 2011
embryo development disrupted, abnormal Fig. 2 with image from Yu et al., 2011
epiboly involved in gastrulation with mouth forming second disrupted, abnormal Fig. 2 with imageFig. 3 with image from Yu et al., 2011
EVL cell morphology, abnormal Fig. 4 with imageFig. 6 with image from Yu et al., 2011
margin constricted, abnormal Fig. 2 with image from Yu et al., 2011
post-vent region kinked, abnormal Fig. 2 with image from Yu et al., 2011
whole organism decreased length, abnormal Fig. 2 with image from Yu et al., 2011
whole organism edematous, abnormal Fig. 2 with image from Yu et al., 2011
whole organism viability, abnormal Fig. 2 with image from Yu et al., 2011

Phenotype of all Fish created by or utilizing MO1-git2a
Phenotype Fish Conditions Figures
whole organism edematous, abnormal AB + MO1-git2a standard conditions Fig. 2 with image from Yu et al., 2011
post-vent region kinked, abnormal AB + MO1-git2a standard conditions Fig. 2 with image from Yu et al., 2011
margin constricted, abnormal AB + MO1-git2a standard conditions Fig. 2 with image from Yu et al., 2011
whole organism decreased length, abnormal AB + MO1-git2a standard conditions Fig. 2 with image from Yu et al., 2011
embryo development disrupted, abnormal AB + MO1-git2a standard conditions Fig. 2 with image from Yu et al., 2011
whole organism viability, abnormal AB + MO1-git2a standard conditions Fig. 2 with image from Yu et al., 2011
EVL cell morphology, abnormal AB + MO1-git2a standard conditions Fig. 4 with imageFig. 6 with image from Yu et al., 2011
epiboly involved in gastrulation with mouth forming second disrupted, abnormal AB + MO1-git2a standard conditions Fig. 2 with imageFig. 3 with image from Yu et al., 2011
cell migration involved in gastrulation decreased rate, abnormal AB + MO1-git2a standard conditions Fig. 3 with image from Yu et al., 2011
cell migration involved in gastrulation disrupted, abnormal AB + MO1-git2a standard conditions Fig. 3 with image from Yu et al., 2011
cell migration involved in gastrulation process quality, abnormal AB + MO1-git2a standard conditions Fig. 3 with image from Yu et al., 2011
embryo development delayed, abnormal AB + MO1-git2a standard conditions Fig. 2 with image from Yu et al., 2011
OTHER MO1-git2a MORPHOLINO PAGESNo links to external sites
CITATIONS (1)