header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-101105-3
Morpholino Name: MO5-birc5b
Target: birc5b (1)
Previous Name: sur2-MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CGCCATCTGAGGACAAGATTCACAC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO5-birc5b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO5-birc5b
Expressed Gene Anatomy Figures
egr2b Fig. 5 from Ma et al., 2009
gata1a Fig. 5 from Ma et al., 2009
hbae1.1 Fig. 5 from Ma et al., 2009
hbbe1.1 Fig. 5 from Ma et al., 2009
lcp1 Fig. 5 from Ma et al., 2009
lmo2 Fig. 5 from Ma et al., 2009
neurog1 Fig. 5 from Ma et al., 2009
pax2a Fig. 5 from Ma et al., 2009
spi1b Fig. 5 from Ma et al., 2009
tal1 Fig. 5 from Ma et al., 2009
PHENOTYPE
Phenotype resulting from MO5-birc5b
Phenotype of all Fish created by or utilizing MO5-birc5b
Genome Resources:
CITATIONS (1)