ZFIN ID: ZDB-MRPHLNO-101101-1
Morpholino Name: MO1-col15a1b
Target: col15a1b (1)
Sequence:
5' - TGCTCAGCCCGACGAGGTAGATGAG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-col15a1b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-col15a1b
Expressed Gene Anatomy Figures
alcama Fig. 4 from Gonzalez-Nunez et al., 2010
atoh7 Fig. 5 from Gonzalez-Nunez et al., 2010
calb2b Fig. 4 from Gonzalez-Nunez et al., 2010
gli1 Fig. 6 from Gonzalez-Nunez et al., 2010
mex3b Fig. 5 from Gonzalez-Nunez et al., 2010
notch1a Fig. 6 from Gonzalez-Nunez et al., 2010
prox1a Fig. 4 from Gonzalez-Nunez et al., 2010
rbpjb Fig. 6 from Gonzalez-Nunez et al., 2010
rx2 Fig. 5 from Gonzalez-Nunez et al., 2010
shha Fig. 6 from Gonzalez-Nunez et al., 2010
vsx2 Fig. 5 from Gonzalez-Nunez et al., 2010
PHENOTYPE
Phenotype resulting from MO1-col15a1b
Phenotype of all Fish created by or utilizing MO1-col15a1b
Genome Resources:
CITATIONS (1)