ZFIN ID: ZDB-MRPHLNO-101015-2
Morpholino Name: MO1-cplx4a
Target: cplx4a (1)
Sequence:
5' - AAACGCCATTATTTACCACGCCGGA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-cplx4a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-cplx4a
Expressed Gene Anatomy Figures
cplx4a Fig. 7 from Vaithianathan et al., 2013
Fig. 11 with imagetext only from Zanazzi et al., 2010
ctbp2l Fig. 8 from Vaithianathan et al., 2013
PHENOTYPE
Phenotype resulting from MO1-cplx4a
Phenotype of all Fish created by or utilizing MO1-cplx4a
Genome Resources:
CITATIONS (2)