Morpholino

MO1-lum

ID
ZDB-MRPHLNO-100915-1
Name
MO1-lum
Previous Names
  • zlum-MO (1)
Target
Sequence
5' - GATCCCAGAGCAAACATGGCTGCAC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
targeted to translation start site
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-lum
Expressed Gene Anatomy Figures
lum Fig. 1 from Lin et al., 2021
Fig. 8 from Yeh et al., 2010
Phenotype
Phenotype resulting from MO1-lum
Phenotype Fish Figures
collagen fibril organization process quality, abnormal WT + MO1-lum Fig. 9 from Yeh et al., 2010
corneal stroma supramolecular fiber increased diameter, abnormal WT + MO1-lum Fig. 9 from Yeh et al., 2010
embryonic camera-type eye morphogenesis process quality, abnormal WT + MO1-lum Fig. 8 from Yeh et al., 2010
eye distended, abnormal WT + MO1-lum Fig. 8 from Yeh et al., 2010
pericardium increased size, abnormal AB/TU + MO1-lum Fig. 2 from Lin et al., 2021
sclera lum expression decreased amount, abnormal AB/TU + MO1-lum Fig. 1 from Lin et al., 2021
sclera ab1-lum labeling decreased amount, abnormal AB/TU + MO1-lum Fig. 1 from Lin et al., 2021
sclera Ab2-tgfb2 labeling decreased amount, abnormal AB/TU + MO1-lum Fig. 1 from Lin et al., 2021
sclera Ab6-col1a1 labeling decreased amount, abnormal AB/TU + MO1-lum Fig. 1 from Lin et al., 2021
sclera ab1-mmp2 labeling increased amount, abnormal AB/TU + MO1-lum Fig. 1 from Lin et al., 2021
sclera increased diameter, abnormal AB/TU + MO1-lum Fig. 2 from Lin et al., 2021
sclera anterior region decreased thickness, abnormal WT + MO1-lum Fig. 10 from Yeh et al., 2010
sclera fibroblast decreased amount, abnormal WT + MO1-lum Fig. 10 from Yeh et al., 2010
sclera posterior region decreased thickness, abnormal WT + MO1-lum Fig. 10 from Yeh et al., 2010
trunk malformed, abnormal AB/TU + MO1-lum Fig. 2 from Lin et al., 2021
whole organism hypoplastic, abnormal WT + MO1-lum Fig. 8 from Yeh et al., 2010
Phenotype of all Fish created by or utilizing MO1-lum
Phenotype Fish Conditions Figures
sclera ab1-lum labeling decreased amount, abnormal AB/TU + MO1-lum standard conditions Fig. 1 from Lin et al., 2021
sclera diameter, ameliorated AB/TU + MO1-lum chemical treatment by environment: doxycycline Fig. 3 from Lin et al., 2021
sclera increased diameter, abnormal AB/TU + MO1-lum standard conditions Fig. 2 from Lin et al., 2021
trunk malformed, abnormal AB/TU + MO1-lum standard conditions Fig. 2 from Lin et al., 2021
sclera lum expression decreased amount, abnormal AB/TU + MO1-lum standard conditions Fig. 1 from Lin et al., 2021
sclera Ab6-col1a1 labeling decreased amount, abnormal AB/TU + MO1-lum standard conditions Fig. 1 from Lin et al., 2021
sclera diameter, ameliorated AB/TU + MO1-lum chemical treatment by environment: minocycline Fig. 3 from Lin et al., 2021
sclera ab1-mmp2 labeling increased amount, abnormal AB/TU + MO1-lum standard conditions Fig. 1 from Lin et al., 2021
sclera diameter, ameliorated AB/TU + MO1-lum chemical treatment by environment: marimastat Fig. 3 from Lin et al., 2021
sclera Ab2-tgfb2 labeling decreased amount, abnormal AB/TU + MO1-lum standard conditions Fig. 1 from Lin et al., 2021
sclera diameter, ameliorated AB/TU + MO1-lum chemical treatment by environment: atropine Fig. 2 from Lin et al., 2021
pericardium increased size, abnormal AB/TU + MO1-lum standard conditions Fig. 2 from Lin et al., 2021
collagen fibril organization process quality, abnormal WT + MO1-lum standard conditions Fig. 9 from Yeh et al., 2010
sclera fibroblast decreased amount, abnormal WT + MO1-lum standard conditions Fig. 10 from Yeh et al., 2010
sclera posterior region decreased thickness, abnormal WT + MO1-lum standard conditions Fig. 10 from Yeh et al., 2010
whole organism hypoplastic, abnormal WT + MO1-lum standard conditions Fig. 8 from Yeh et al., 2010
sclera anterior region decreased thickness, abnormal WT + MO1-lum standard conditions Fig. 10 from Yeh et al., 2010
embryonic camera-type eye morphogenesis process quality, abnormal WT + MO1-lum standard conditions Fig. 8 from Yeh et al., 2010
eye distended, abnormal WT + MO1-lum standard conditions Fig. 8 from Yeh et al., 2010
corneal stroma supramolecular fiber increased diameter, abnormal WT + MO1-lum standard conditions Fig. 9 from Yeh et al., 2010
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.