Morpholino

MO1-daw1

ID

ZDB-MRPHLNO-100806-1

Name

MO1-daw1

Previous Names

MO AUG (1)
MO1-wdr69

Target

daw1 (1)

Sequence

5' - TGTGCATCCGTTTCAGTCTCATCAC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-daw1

Expressed Gene	Anatomy	Figures
foxa3	liver	Fig. 3 from Gao et al., 2010
myl7	heart tube	Fig. 3 from Gao et al., 2010
spaw	lateral plate mesoderm right side	Fig. 3 from Gao et al., 2010

Phenotype

Phenotype resulting from MO1-daw1

Phenotype	Fish	Figures
cilium movement disrupted, abnormal	AB + MO1-daw1	Fig. 5 from Gao et al., 2010
determination of left/right asymmetry in lateral mesoderm disrupted, abnormal	AB + MO1-daw1	Fig. 3 from Gao et al., 2010
determination of liver left/right asymmetry disrupted, abnormal	AB + MO1-daw1	Fig. 3 from Gao et al., 2010
heart looping disrupted, abnormal	AB + MO1-daw1	Fig. 3 from Gao et al., 2010
heart tube mislocalised radially, abnormal	AB + MO1-daw1	Fig. 3 from Gao et al., 2010
Kupffer's vesicle axonemal dynein complex decreased amount, abnormal	AB + MO1-daw1	Fig. 5 from Gao et al., 2010
Kupffer's vesicle axoneme structure, abnormal	AB + MO1-daw1	Fig. 5 from Gao et al., 2010
Kupffer's vesicle cilium decreased coordination, abnormal	AB + MO1-daw1	Fig. 5 from Gao et al., 2010
Kupffer's vesicle cilium movement quality, abnormal	AB + MO1-daw1	Fig. 5 from Gao et al., 2010
liver mislocalised radially, abnormal	AB + MO1-daw1	Fig. 3 from Gao et al., 2010
otic vesicle has extra parts of type otolith, abnormal	AB + MO1-daw1	Fig. 2 from Gao et al., 2010
otolith mislocalised, abnormal	AB + MO1-daw1	Fig. 2 from Gao et al., 2010
pericardium edematous, abnormal	AB + MO1-daw1	Fig. 2 from Gao et al., 2010
post-vent region curved ventral, abnormal	AB + MO1-daw1	Fig. 2 from Gao et al., 2010
pronephros cystic, abnormal	AB + MO1-daw1	Fig. 2 from Gao et al., 2010

Phenotype of all Fish created by or utilizing MO1-daw1

Phenotype	Fish	Conditions	Figures
cilium movement disrupted, abnormal	AB + MO1-daw1	standard conditions	Fig. 5 from Gao et al., 2010
heart tube mislocalised radially, abnormal	AB + MO1-daw1	standard conditions	Fig. 3 from Gao et al., 2010
Kupffer's vesicle axoneme structure, abnormal	AB + MO1-daw1	standard conditions	Fig. 5 from Gao et al., 2010
Kupffer's vesicle cilium decreased coordination, abnormal	AB + MO1-daw1	standard conditions	Fig. 5 from Gao et al., 2010
determination of left/right asymmetry in lateral mesoderm disrupted, abnormal	AB + MO1-daw1	standard conditions	Fig. 3 from Gao et al., 2010
pronephros cystic, abnormal	AB + MO1-daw1	standard conditions	Fig. 2 from Gao et al., 2010
heart looping disrupted, abnormal	AB + MO1-daw1	standard conditions	Fig. 3 from Gao et al., 2010
determination of liver left/right asymmetry disrupted, abnormal	AB + MO1-daw1	standard conditions	Fig. 3 from Gao et al., 2010
Kupffer's vesicle cilium movement quality, abnormal	AB + MO1-daw1	standard conditions	Fig. 5 from Gao et al., 2010
otic vesicle has extra parts of type otolith, abnormal	AB + MO1-daw1	standard conditions	Fig. 2 from Gao et al., 2010
post-vent region curved ventral, abnormal	AB + MO1-daw1	standard conditions	Fig. 2 from Gao et al., 2010
liver mislocalised radially, abnormal	AB + MO1-daw1	standard conditions	Fig. 3 from Gao et al., 2010
pericardium edematous, abnormal	AB + MO1-daw1	standard conditions	Fig. 2 from Gao et al., 2010
Kupffer's vesicle axonemal dynein complex decreased amount, abnormal	AB + MO1-daw1	standard conditions	Fig. 5 from Gao et al., 2010
otolith mislocalised, abnormal	AB + MO1-daw1	standard conditions	Fig. 2 from Gao et al., 2010

Citations