ZFIN ID: ZDB-MRPHLNO-100617-4
Morpholino Name: MO1-ush2a
Target: ush2a (1)
Sequence:
5' - GTACGACCTTATGCTTACCTGTTGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-ush2a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-ush2a No data available
PHENOTYPE 
Phenotype resulting from MO1-ush2a
Phenotype Figures
eye photoreceptor cell apoptotic, abnormal Fig. 5 from Ebermann et al., 2010

Phenotype of all Fish created by or utilizing MO1-ush2a
Phenotype Fish Conditions Figures
eye photoreceptor cell apoptotic, abnormal AB + MO1-ush2a standard conditions Fig. 5 from Ebermann et al., 2010
eye photoreceptor cell apoptotic, abnormal AB + MO1-pdzd7a + MO1-ush2a standard conditions Fig. 5 from Ebermann et al., 2010
OTHER MO1-ush2a MORPHOLINO PAGESNo links to external sites
CITATIONS (1)