Morpholino

MO1-dok7

ID
ZDB-MRPHLNO-100602-5
Name
MO1-dok7
Previous Names
  • zDok-7 translation-blocking MO1 (1)
Target
Sequence
5' - CTCTACGACAACCGTATCCGTCATC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
translation-blocker
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-dok7
No data available
Phenotype
Phenotype resulting from MO1-dok7
No data available
Phenotype of all Fish created by or utilizing MO1-dok7
No data available
Citations