ZFIN ID: ZDB-MRPHLNO-100519-1
Morpholino Name: MO3-tmie
Target: tmie (1)
Sequence:
5' - GCAATTACACTTGCAGAAACTTACT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-tmie No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-tmie No data available
PHENOTYPE
Phenotype resulting from MO3-tmie
Phenotype of all Fish created by or utilizing MO3-tmie
Genome Resources:
CITATIONS (1)