header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-100504-5
Morpholino Name: MO4-mmp9
Target: mmp9 (1)
Sequence:
5' - CGCCAGGACTCCAAGTCTCATTTTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: translation blocker
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO4-mmp9 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO4-mmp9
Expressed Gene Anatomy Figures
myb Fig. 2 with imageFig. 5 with image from Theodore et al., 2017
runx1 Fig. 2 with image from Theodore et al., 2017
PHENOTYPE
Phenotype resulting from MO4-mmp9
No data available

Phenotype of all Fish created by or utilizing MO4-mmp9
OTHER MO4-mmp9 MORPHOLINO PAGESNo links to external sites
CITATIONS (6)