ZFIN ID: ZDB-MRPHLNO-100429-5
Morpholino Name: MO1-lbx2
Target: lbx2 (1)
Sequence:
5' - TCATGTCTTTAGAGCTGGAGGTCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: targets start site
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-lbx2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-lbx2 No data available
PHENOTYPE 
Phenotype resulting from MO1-lbx2
Phenotype Figures
fast muscle cell malformed, abnormal Fig. S2 with image from Ochi et al., 2009
slow muscle cell malformed, abnormal Fig. S2 with image from Ochi et al., 2009

Phenotype of all Fish created by or utilizing MO1-lbx2
Phenotype Fish Conditions Figures
fast muscle cell malformed, abnormal WT + MO1-lbx2 standard conditions Fig. S2 with image from Ochi et al., 2009
slow muscle cell malformed, abnormal WT + MO1-lbx2 standard conditions Fig. S2 with image from Ochi et al., 2009
OTHER MO1-lbx2 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)