header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-100427-16
Morpholino Name: MO1-hoxd13a
Target: hoxd13a (1)
Sequence:
5' - CAGAGCTGAGGTCTTACCTGTTAAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice blocking MO
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-hoxd13a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-hoxd13a
Expressed Gene Anatomy Figures
shha Fig. 2 with image from Sakamoto et al., 2009
PHENOTYPE
Phenotype resulting from MO1-hoxd13a
No data available

Phenotype of all Fish created by or utilizing MO1-hoxd13a
No data available
OTHER MO1-hoxd13a MORPHOLINO PAGESNo links to external sites
CITATIONS (1)