header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-100420-4
Morpholino Name: MO2-hgfa
Target: hgfa (1)
Previous Name: hgf1-E616 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - AGATGAGGTGATGTCTTACCATCTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-hgfa No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-hgfa No data available
PHENOTYPE
Phenotype resulting from MO2-hgfa
No data available

Phenotype of all Fish created by or utilizing MO2-hgfa
Phenotype Fish Conditions Figures
cerebellum morphogenesis disrupted, abnormal WT + MO1-hgfb + MO2-hgfa standard conditions Fig. 3 with image from Elsen et al., 2009
cell proliferation in hindbrain decreased rate, abnormal WT + MO1-hgfb + MO2-hgfa standard conditions Fig. 5 with image from Elsen et al., 2009
cerebellar granule cell differentiation disrupted, abnormal WT + MO1-hgfb + MO2-hgfa standard conditions Fig. 4 with image from Elsen et al., 2009
central nervous system neuron differentiation disrupted, abnormal WT + MO1-hgfb + MO2-hgfa standard conditions Fig. 3 with image from Elsen et al., 2009
cell proliferation in midbrain decreased rate, abnormal WT + MO1-hgfb + MO2-hgfa standard conditions Fig. 5 with image from Elsen et al., 2009
cerebellum development disrupted, abnormal WT + MO1-hgfb + MO2-hgfa standard conditions Fig. 3 with image from Elsen et al., 2009
cerebellum cerebellar granule cell decreased amount, abnormal WT + MO1-hgfb + MO2-hgfa standard conditions Fig. 4 with image from Elsen et al., 2009
central nervous system neuron differentiation disrupted, abnormal knu3Tg + MO1-hgfb + MO2-hgfa standard conditions Fig. 2 with image from Elsen et al., 2009
cerebellum development disrupted, abnormal knu3Tg + MO1-hgfb + MO2-hgfa standard conditions Fig. 2 with image from Elsen et al., 2009
cerebellum morphogenesis disrupted, abnormal knu3Tg + MO1-hgfb + MO2-hgfa standard conditions Fig. 2 with image from Elsen et al., 2009
cerebellum neuron decreased amount, abnormal knu3Tg + MO1-hgfb + MO2-hgfa standard conditions Fig. 2 with image from Elsen et al., 2009
neuron migration disrupted, abnormal rw0Tg + MO1-hgfb + MO2-hgfa standard conditions Fig. 7 with image from Elsen et al., 2009
OTHER MO2-hgfa MORPHOLINO PAGESNo links to external sites
CITATIONS (1)