header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-100416-8
Morpholino Name: MO5-irx4a
Target: irx4a (1)
Previous Name: MO4as (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CAATCTGAGCATCTTACCTGAGGTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice blocking MO designed to bind to the donor splice site between exon 2 and intron 2.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO5-irx4a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO5-irx4a
Expressed Gene Anatomy Figures
egr2b Fig. 2 with imageFig. 3 with image from Feijoo et al., 2009
emx3 Fig. 3 with image from Feijoo et al., 2009
eya1 Fig. 4 with imageFig. 7 with image from Feijoo et al., 2009
irx4a Fig. 1 with image from Feijoo et al., 2009
myh6 Fig. 8 with image from Feijoo et al., 2009
myh7 Fig. 8 with image from Feijoo et al., 2009
neurod1 Fig. 4 with imageFig. 5 with image from Feijoo et al., 2009
neurog1 Fig. 4 with image from Feijoo et al., 2009
pax2a Fig. 2 with imageFig. 3 with image from Feijoo et al., 2009
pax8 Fig. 5 with image from Feijoo et al., 2009
rx3 Fig. 2 with image from Feijoo et al., 2009
six4b Fig. 4 with image from Feijoo et al., 2009
sox2 Fig. 2 with imageFig. 7 with image from Feijoo et al., 2009
PHENOTYPE
Phenotype resulting from MO5-irx4a
Phenotype of all Fish created by or utilizing MO5-irx4a
OTHER MO5-irx4a MORPHOLINO PAGES No links to external sites
CITATIONS (1)