header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-100414-6
Morpholino Name: MO2-arnt2
Target: arnt2 (1)
Sequence:
5' - GGTTTACAGCGGCTGGTGTTGCCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-arnt2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-arnt2
Expressed Gene Anatomy Figures
cdh4 Fig. 2 from Hsieh et al., 2008
PHENOTYPE
Phenotype resulting from MO2-arnt2
Phenotype of all Fish created by or utilizing MO2-arnt2
OTHER MO2-arnt2 MORPHOLINO PAGESNo links to external sites
CITATIONS (2)