Morpholino

MO1-atp2b1a

ID

ZDB-MRPHLNO-100414-3

Name

MO1-atp2b1a

Previous Names

atp2b1a-MO1 (1)

Target

atp2b1a (1)

Sequence

5' - GCTGTATGAGTTGTTAGCCATGTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-atp2b1a

No data available

Phenotype

Phenotype resulting from MO1-atp2b1a

Phenotype	Fish	Figures
anterior crista hair cell decreased amount, abnormal	WT + MO1-atp2b1a	Fig. 7 from Cruz et al., 2009
hair cell anterior macula decreased amount, abnormal	WT + MO1-atp2b1a	Fig. 7 from Cruz et al., 2009
hair cell posterior macula decreased amount, abnormal	WT + MO1-atp2b1a	Fig. 7 from Cruz et al., 2009
integument ionocyte morphology, abnormal	WT + MO1-atp2b1a	Fig. 6 from Cruz et al., 2009
lateral crista hair cell decreased amount, abnormal	WT + MO1-atp2b1a	Fig. 7 from Cruz et al., 2009
macula saccule hair cell decreased amount, abnormal	WT + MO1-atp2b1a	Fig. 7 from Cruz et al., 2009
macula utricle hair cell decreased amount, abnormal	WT + MO1-atp2b1a	Fig. 7 from Cruz et al., 2009
otolith fused with otolith, abnormal	WT + MO1-atp2b1a	Fig. 3, Fig. 4 from Cruz et al., 2009
posterior crista hair cell decreased amount, abnormal	WT + MO1-atp2b1a	Fig. 7 from Cruz et al., 2009
posterior lateral line neuromast neuromast hair cell decreased amount, abnormal	WT + MO1-atp2b1a	Fig. 6 from Cruz et al., 2009
sagitta decreased size, abnormal	WT + MO1-atp2b1a	Fig. 4 from Cruz et al., 2009
sagitta immature, abnormal	WT + MO1-atp2b1a	Fig. 4 from Cruz et al., 2009
sagitta mislocalised, abnormal	WT + MO1-atp2b1a	Fig. 4 from Cruz et al., 2009
semicircular canal immature, abnormal	WT + MO1-atp2b1a	Fig. 4 from Cruz et al., 2009

Phenotype of all Fish created by or utilizing MO1-atp2b1a

Phenotype	Fish	Conditions	Figures
hair cell anterior macula decreased amount, abnormal	WT + MO1-atp2b1a	standard conditions	Fig. 7 from Cruz et al., 2009
semicircular canal immature, abnormal	WT + MO1-atp2b1a	standard conditions	Fig. 4 from Cruz et al., 2009
sagitta decreased size, abnormal	WT + MO1-atp2b1a	standard conditions	Fig. 4 from Cruz et al., 2009
lateral crista hair cell decreased amount, abnormal	WT + MO1-atp2b1a	standard conditions	Fig. 7 from Cruz et al., 2009
sagitta immature, abnormal	WT + MO1-atp2b1a	standard conditions	Fig. 4 from Cruz et al., 2009
macula utricle hair cell decreased amount, abnormal	WT + MO1-atp2b1a	standard conditions	Fig. 7 from Cruz et al., 2009
macula saccule hair cell decreased amount, abnormal	WT + MO1-atp2b1a	standard conditions	Fig. 7 from Cruz et al., 2009
sagitta mislocalised, abnormal	WT + MO1-atp2b1a	standard conditions	Fig. 4 from Cruz et al., 2009
otolith fused with otolith, abnormal	WT + MO1-atp2b1a	standard conditions	Fig. 3, Fig. 4 from Cruz et al., 2009
posterior crista hair cell decreased amount, abnormal	WT + MO1-atp2b1a	standard conditions	Fig. 7 from Cruz et al., 2009
posterior lateral line neuromast neuromast hair cell decreased amount, abnormal	WT + MO1-atp2b1a	standard conditions	Fig. 6 from Cruz et al., 2009
anterior crista hair cell decreased amount, abnormal	WT + MO1-atp2b1a	standard conditions	Fig. 7 from Cruz et al., 2009
hair cell posterior macula decreased amount, abnormal	WT + MO1-atp2b1a	standard conditions	Fig. 7 from Cruz et al., 2009
integument ionocyte morphology, abnormal	WT + MO1-atp2b1a	standard conditions	Fig. 6 from Cruz et al., 2009

Citations