ZFIN ID: ZDB-MRPHLNO-100405-1
Morpholino Name: MO1-ihha
Target: ihha (1)
Previous Name: Ihha-MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GGAGACGCATTCCACCGCAAGCG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-ihha No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-ihha
Expressed Gene Anatomy Figures
acta2 Fig. 4 with image from Winata et al., 2009
anxa5b Fig. 4 with image from Winata et al., 2009
fgf10a Fig. 4 with image from Winata et al., 2009
foxa1 Fig. 3 with image from Korzh et al., 2011
gata6 Fig. 3 with image from Korzh et al., 2011
mnx1 Fig. 6 with image from Korzh et al., 2011
Fig. 4 with image from Winata et al., 2009
ptch1 Fig. S7 with image from Winata et al., 2009
ptch2 Fig. S7 with image from Winata et al., 2009
wif1 Fig. 6 from Yin et al., 2012
PHENOTYPE
Phenotype resulting from MO1-ihha
Phenotype Figures
enteric neuron decreased amount, abnormal Fig. 4 with image from Sribudiani et al., 2018
eye decreased size, abnormal Fig. 4 with image from Sribudiani et al., 2018
head morphology, abnormal Fig. 4 with image from Sribudiani et al., 2018
pancreas morphology, abnormal Fig. 6 from Yin et al., 2012
smoothened signaling pathway disrupted, abnormal Fig. S7 with image from Winata et al., 2009
swim bladder absent, abnormal Fig. 4 with image from Sribudiani et al., 2018
swim bladder decreased size, abnormal Fig. 6 from Yin et al., 2012
Fig. 4 with image from Winata et al., 2009
swim bladder hypoplastic, abnormal Fig. 4 with imageFig. S3 with imageFig. S7 with image from Winata et al., 2009
swim bladder epithelium decreased size, abnormal Fig. 4 with image from Winata et al., 2009
swim bladder mesenchyme decreased size, abnormal Fig. 4 with image from Winata et al., 2009
swim bladder mesenchyme disorganized, abnormal Fig. 4 with image from Winata et al., 2009
swim bladder mesothelial cell decreased amount, abnormal Fig. 4 with image from Winata et al., 2009
swim bladder smooth muscle aplastic, abnormal Fig. 4 with image from Winata et al., 2009
swim bladder bud hypoplastic, abnormal Fig. S3 with image from Winata et al., 2009
swim bladder development disrupted, abnormal Fig. 6 from Yin et al., 2012
swim bladder formation disrupted, abnormal Fig. S7 with image from Winata et al., 2009
swim bladder morphogenesis disrupted, abnormal Fig. S3 with image from Winata et al., 2009
trunk increased curvature, abnormal Fig. 4 with image from Sribudiani et al., 2018

Phenotype of all Fish created by or utilizing MO1-ihha
Phenotype Fish Conditions Figures
swim bladder epithelium decreased size, abnormal AB + MO1-ihha standard conditions Fig. 4 with image from Winata et al., 2009
smoothened signaling pathway disrupted, abnormal AB + MO1-ihha standard conditions Fig. S7 with image from Winata et al., 2009
swim bladder hypoplastic, abnormal AB + MO1-ihha standard conditions Fig. 4 with imageFig. S3 with imageFig. S7 with image from Winata et al., 2009
swim bladder bud hypoplastic, abnormal AB + MO1-ihha standard conditions Fig. S3 with image from Winata et al., 2009
swim bladder morphogenesis disrupted, abnormal AB + MO1-ihha standard conditions Fig. S3 with image from Winata et al., 2009
swim bladder smooth muscle aplastic, abnormal AB + MO1-ihha standard conditions Fig. 4 with image from Winata et al., 2009
swim bladder mesenchyme disorganized, abnormal AB + MO1-ihha standard conditions Fig. 4 with image from Winata et al., 2009
swim bladder formation disrupted, abnormal AB + MO1-ihha standard conditions Fig. S7 with image from Winata et al., 2009
swim bladder mesothelial cell decreased amount, abnormal AB + MO1-ihha standard conditions Fig. 4 with image from Winata et al., 2009
swim bladder mesenchyme decreased size, abnormal AB + MO1-ihha standard conditions Fig. 4 with image from Winata et al., 2009
swim bladder morphogenesis disrupted, abnormal AB + MO1-ihha + MO4-tp53 standard conditions Fig. S3 with image from Winata et al., 2009
swim bladder bud hypoplastic, abnormal AB + MO1-ihha + MO4-tp53 standard conditions Fig. S3 with image from Winata et al., 2009
swim bladder hypoplastic, abnormal AB + MO1-ihha + MO4-tp53 standard conditions Fig. S3 with image from Winata et al., 2009
swim bladder decreased size, abnormal WT + MO1-ihha standard conditions Fig. 6 from Yin et al., 2012
swim bladder development disrupted, abnormal WT + MO1-ihha standard conditions Fig. 6 from Yin et al., 2012
pancreas morphology, abnormal WT + MO1-ihha standard conditions Fig. 6 from Yin et al., 2012
head morphology, abnormal em2Tg + MO1-ihha + MO4-tp53 standard conditions Fig. 4 with image from Sribudiani et al., 2018
enteric neuron decreased amount, abnormal em2Tg + MO1-ihha + MO4-tp53 standard conditions Fig. 4 with image from Sribudiani et al., 2018
eye decreased size, abnormal em2Tg + MO1-ihha + MO4-tp53 standard conditions Fig. 4 with image from Sribudiani et al., 2018
swim bladder absent, abnormal em2Tg + MO1-ihha + MO4-tp53 standard conditions Fig. 4 with image from Sribudiani et al., 2018
trunk increased curvature, abnormal em2Tg + MO1-ihha + MO4-tp53 standard conditions Fig. 4 with image from Sribudiani et al., 2018
swim bladder decreased size, abnormal sqet332Et + MO1-ihha standard conditions Fig. 4 with image from Winata et al., 2009
swim bladder decreased size, abnormal fgf10atbvbo/tbvbo; sqet332Et + MO1-ihha standard conditions Fig. 8 with image from Korzh et al., 2011
pneumatic duct decreased size, abnormal fgf10atbvbo/tbvbo; sqet332Et + MO1-ihha standard conditions Fig. 8 with image from Korzh et al., 2011
OTHER MO1-ihha MORPHOLINO PAGESNo links to external sites
CITATIONS (4)