ZFIN ID: ZDB-MRPHLNO-100323-3
Morpholino Name: MO2-nf1a
Target: nf1a (1)
Previous Names: nf1a-e1 (1), nf1a SB MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GTCCAAGTAGTGTTTTCCTTACCTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-nf1a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-nf1a No data available
PHENOTYPE
Phenotype resulting from MO2-nf1a
No data available

Phenotype of all Fish created by or utilizing MO2-nf1a
No data available
OTHER MO2-nf1a MORPHOLINO PAGESNo links to external sites
CITATIONS (2)