ZFIN ID: ZDB-MRPHLNO-100323-1
Morpholino Name: MO1-nf1a
Target: nf1a (1)
Previous Name: nf1a ATG MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GGCTTGTGCGCCGCCATGCTCAGGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-nf1a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-nf1a No data available
PHENOTYPE
Phenotype resulting from MO1-nf1a
Phenotype Figures
atrioventricular valve decreased functionality, abnormal Fig. 3 from Padmanabhan et al., 2009
blood circulation disrupted, abnormal Fig. 3 from Padmanabhan et al., 2009
intersegmental vessel morphology, abnormal Fig. 4 from Padmanabhan et al., 2009
pericardium edematous, abnormal Fig. 3 from Padmanabhan et al., 2009

Phenotype of all Fish created by or utilizing MO1-nf1a
Phenotype Fish Conditions Figures
atrioventricular valve decreased functionality, abnormal WT + MO1-nf1a standard conditions Fig. 3 from Padmanabhan et al., 2009
blood circulation disrupted, abnormal WT + MO1-nf1a standard conditions Fig. 3 from Padmanabhan et al., 2009
pericardium edematous, abnormal WT + MO1-nf1a standard conditions Fig. 3 from Padmanabhan et al., 2009
intersegmental vessel morphology, abnormal y1Tg + MO1-nf1a standard conditions Fig. 4 from Padmanabhan et al., 2009
blood circulation disrupted, abnormal WT + MO1-nf1a + MO1-nf1b standard conditions Fig. 3 from Padmanabhan et al., 2009
atrioventricular valve decreased functionality, abnormal WT + MO1-nf1a + MO1-nf1b standard conditions Fig. 3 from Padmanabhan et al., 2009
ventricular myocardium decreased thickness, abnormal WT + MO1-nf1a + MO1-nf1b standard conditions Fig. 3 from Padmanabhan et al., 2009
pericardium edematous, abnormal WT + MO1-nf1a + MO1-nf1b standard conditions Fig. 3 from Padmanabhan et al., 2009
blood circulation disrupted, abnormal WT + MO1-nf1a + MO1-nf1b + MO4-tp53 standard conditions Fig. 3 from Padmanabhan et al., 2009
atrioventricular valve decreased functionality, abnormal WT + MO1-nf1a + MO1-nf1b + MO4-tp53 standard conditions Fig. 3 from Padmanabhan et al., 2009
pericardium edematous, abnormal WT + MO1-nf1a + MO1-nf1b + MO4-tp53 standard conditions Fig. 3 from Padmanabhan et al., 2009
intersegmental vessel aplastic, abnormal y7Tg + MO1-nf1a + MO1-nf1b standard conditions Fig. 5 from Padmanabhan et al., 2009
OTHER MO1-nf1a MORPHOLINO PAGESNo links to external sites
CITATIONS (1)