ZFIN ID: ZDB-MRPHLNO-100224-1
Morpholino Name: MO1-prkcsh
Target: prkcsh (1)
Sequence:
5' - TCAACAATAGATGCACGCAGGTCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-prkcsh No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-prkcsh No data available
PHENOTYPE
Phenotype resulting from MO1-prkcsh
Phenotype of all Fish created by or utilizing MO1-prkcsh
Phenotype Fish Conditions Figures
liver cystic, abnormal WT + MO1-prkcsh standard conditions Fig. 3Fig. 4Fig. 5Fig. 6 from Tietz Bogert et al., 2013
embryonic morphogenesis disrupted, abnormal WT + MO1-prkcsh standard conditions Fig. 1 from Gao et al., 2010
heart looping disrupted, abnormal WT + MO1-prkcsh standard conditions Fig. 1Fig. 2 from Gao et al., 2010
trunk malformed, abnormal WT + MO1-prkcsh standard conditions Fig. 2 from Gao et al., 2010
post-vent region kinked, abnormal WT + MO1-prkcsh standard conditions Fig. 2 from Tietz Bogert et al., 2013
pronephros cystic, abnormal WT + MO1-prkcsh standard conditions Fig. 1Fig. 2 from Gao et al., 2010
establishment of anatomical structure orientation disrupted, abnormal WT + MO1-prkcsh standard conditions Fig. 1Fig. 2Fig. S2 from Gao et al., 2010
liver cystic, abnormal WT + MO1-prkcsh chemical treatment: menadione Fig. 5 from Tietz Bogert et al., 2013
liver endoplasmic reticulum disoriented, abnormal WT + MO1-prkcsh standard conditions Fig. 6 from Tietz Bogert et al., 2013
liver endoplasmic reticulum swollen, abnormal WT + MO1-prkcsh standard conditions Fig. 6 from Tietz Bogert et al., 2013
whole organism curved lateral, abnormal WT + MO1-prkcsh standard conditions Fig. 2 from Tietz Bogert et al., 2013
trunk curved dorsal, abnormal WT + MO1-prkcsh standard conditions Fig. 1 from Gao et al., 2010
pronephros cystic, abnormal WT + MO1-prkcsh + MO5-pkd2 standard conditions Fig. 4 from Gao et al., 2010
Genome Resources:
CITATIONS (2)