ZFIN ID: ZDB-MRPHLNO-100217-7
Morpholino Name: MO1-usp14
Target: usp14 (1)
Sequence:
5' - TCACATTCACTGTAAATACGGGCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-usp14 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-usp14 No data available
PHENOTYPE
Phenotype resulting from MO1-usp14
No data available

Phenotype of all Fish created by or utilizing MO1-usp14
No data available
Genome Resources:
CITATIONS (1)