Morpholino

MO2-igf2b

ID
ZDB-MRPHLNO-090929-4
Name
MO2-igf2b
Previous Names
  • 2bMO2 (1)
Target
Sequence
5' - TAGTGAAGGTCGGATTAAGTCCCCT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-igf2b
No data available
Phenotype
Phenotype resulting from MO2-igf2b
Phenotype of all Fish created by or utilizing MO2-igf2b
Phenotype Fish Conditions Figures
renal system process disrupted, abnormal AB/TU + MO1-igf2b + MO2-igf2b standard conditions Fig. 6 from White et al., 2009
whole organism curved ventral, abnormal AB/TU + MO1-igf2b + MO2-igf2b standard conditions text only from White et al., 2009
pronephric duct medial side fused with pronephric duct medial side, abnormal AB/TU + MO1-igf2b + MO2-igf2b standard conditions Fig. 6 from White et al., 2009
notochord undulate, abnormal AB/TU + MO1-igf2b + MO2-igf2b standard conditions Fig. 4text only from White et al., 2009
trunk has fewer parts of type somite, abnormal AB/TU + MO1-igf2b + MO2-igf2b standard conditions Fig. 4 from White et al., 2009
whole organism edematous, abnormal AB/TU + MO1-igf2b + MO2-igf2b standard conditions Fig. 6 from White et al., 2009
forebrain morphology, abnormal AB/TU + MO1-igf2b + MO2-igf2b standard conditions Fig. 5 from White et al., 2009
convergent extension involved in axis elongation delayed, abnormal AB/TU + MO1-igf2b + MO2-igf2b standard conditions text only from White et al., 2009
notochord development delayed, abnormal AB/TU + MO1-igf2b + MO2-igf2b standard conditions Fig. 4 from White et al., 2009
somite specification disrupted, abnormal AB/TU + MO1-igf2b + MO2-igf2b standard conditions Fig. 4 from White et al., 2009
notochord undulate, abnormal AB/TU + MO2-igf2b standard conditions text only from White et al., 2009
whole organism curved ventral, abnormal AB/TU + MO2-igf2b standard conditions text only from White et al., 2009
convergent extension involved in axis elongation delayed, abnormal AB/TU + MO2-igf2b standard conditions text only from White et al., 2009
intersegmental vessel sprouting angiogenesis disrupted, abnormal y7Tg + MO2-igf2b + MO3-igf2b + MO4-tp53 standard conditions Fig. 4 with image from Dallinga et al., 2018
intersegmental vessel filopodium decreased amount, abnormal y7Tg + MO2-igf2b + MO3-igf2b + MO4-tp53 standard conditions Fig. 4 with image from Dallinga et al., 2018
trunk has fewer parts of type somite, abnormal AB/TU + MO1-igf2a + MO1-igf2b + MO2-igf2a + MO2-igf2b + MO4-tp53 standard conditions Fig. 4 from White et al., 2009
whole organism curved ventral, abnormal AB/TU + MO1-igf2a + MO1-igf2b + MO2-igf2a + MO2-igf2b + MO4-tp53 standard conditions text only from White et al., 2009
somite specification disrupted, abnormal AB/TU + MO1-igf2a + MO1-igf2b + MO2-igf2a + MO2-igf2b + MO4-tp53 standard conditions Fig. 4 from White et al., 2009
notochord undulate, abnormal AB/TU + MO1-igf2a + MO1-igf2b + MO2-igf2a + MO2-igf2b + MO4-tp53 standard conditions text only from White et al., 2009
Citations