header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-090917-6
Morpholino Name: MO1-alcamb
Target: alcamb (1)
Previous Names: MO-Nb (1), nlcam-ATG-MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GCAGTCTGCGATAGTTCTGCACTCC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: translation-blocker
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-alcamb No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-alcamb
Expressed Gene Anatomy Figures
cntn2 Fig. 7 from Diekmann et al., 2009
emx3 Fig. 6 with image from Brown et al., 2010
rho Fig. 7 from Diekmann et al., 2009
PHENOTYPE
Phenotype resulting from MO1-alcamb
Phenotype of all Fish created by or utilizing MO1-alcamb
OTHER MO1-alcamb MORPHOLINO PAGESNo links to external sites
CITATIONS (2)