Morpholino

MO1-alcama

ID
ZDB-MRPHLNO-090917-5
Name
MO1-alcama
Previous Names
  • MO-Na (1)
Target
Sequence
5' - GTCCGGCGACAGTCTCAATAGAGAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-alcama
Expressed Gene Anatomy Figures
alcama Fig. 5 with image from Choe et al., 2013
Phenotype
Phenotype resulting from MO1-alcama
Phenotype Fish Figures
amacrine cell decreased amount, abnormal s356tTg + MO1-alcama + MO1-tp53 Fig. 7 from Diekmann et al., 2009
cranial nerve II aplastic, abnormal s356tTg + MO1-alcama + MO1-tp53 Fig. 5Fig. 7 from Diekmann et al., 2009
cranial nerve II decreased thickness, abnormal s356tTg + MO1-alcama + MO1-tp53 Fig. 5Fig. 7 from Diekmann et al., 2009
eye decreased diameter, abnormal WT + MO1-alcama + MO1-tp53 Fig. 4 from Diekmann et al., 2009
eye decreased size, abnormal WT + MO1-alcama + MO1-tp53 Fig. 3Fig. 4Fig. S2 from Diekmann et al., 2009
eye mislocalised ventrally, abnormal WT + MO1-alcama + MO1-tp53 Fig. 3 from Diekmann et al., 2009
neuron differentiation arrested, abnormal s356tTg + MO1-alcama + MO1-tp53 Fig. 6Fig. 7 from Diekmann et al., 2009
neuron differentiation decreased rate, abnormal WT + MO1-alcama + MO1-tp53 Fig. 6 from Diekmann et al., 2009
optic nerve head decreased size, abnormal WT + MO1-alcama + MO1-tp53 Fig. 4 from Diekmann et al., 2009
optic nerve head axon absent, abnormal WT + MO1-alcama + MO1-tp53 Fig. 4 from Diekmann et al., 2009
pericardial cavity increased size, abnormal WT + MO1-alcama + MO1-tp53 Fig. 3 from Diekmann et al., 2009
pharyngeal pouch malformed, abnormal WT + MO1-alcama Fig. 5 with image from Choe et al., 2013
pharyngeal pouch adherens junction organization process quality, abnormal WT + MO1-alcama Fig. 5 with image from Choe et al., 2013
pharyngeal pouch apical protein localization decreased occurrence, abnormal WT + MO1-alcama Fig. 5 with image from Choe et al., 2013
retina morphogenesis in camera-type eye disrupted, abnormal s356tTg + MO1-alcama + MO1-tp53 Fig. 6Fig. 7 from Diekmann et al., 2009
retinal ganglion cell decreased amount, abnormal WT + MO1-alcama + MO1-tp53 Fig. 4Fig. 6Fig. 7 from Diekmann et al., 2009
retinal ganglion cell layer morphology, abnormal WT + MO1-alcama + MO1-tp53 Fig. 4 from Diekmann et al., 2009
retinal inner nuclear layer neuron decreased amount, abnormal WT + MO1-alcama + MO1-tp53 Fig. 4 from Diekmann et al., 2009
retinal neural layer nucleus apoptotic, abnormal WT + MO1-alcama + MO1-tp53 Fig. 4 from Diekmann et al., 2009
retinal rod cell differentiation delayed, abnormal s356tTg + MO1-alcama + MO1-tp53 Fig. 7 from Diekmann et al., 2009
retinal rod cell differentiation process quality, abnormal s356tTg + MO1-alcama + MO1-tp53 Fig. 7 from Diekmann et al., 2009
ventral mandibular arch decreased size, abnormal WT + MO1-alcama + MO1-tp53 Fig. 3 from Diekmann et al., 2009
whole organism decreased size, abnormal WT + MO1-alcama + MO1-tp53 Fig. 3 from Diekmann et al., 2009
Phenotype of all Fish created by or utilizing MO1-alcama
Phenotype Fish Conditions Figures
pharyngeal pouch malformed, abnormal WT + MO1-alcama standard conditions Fig. 5 with image from Choe et al., 2013
eye decreased size, abnormal WT + MO1-alcama standard conditions Fig. S2 from Diekmann et al., 2009
pharyngeal pouch apical protein localization decreased occurrence, abnormal WT + MO1-alcama standard conditions Fig. 5 with image from Choe et al., 2013
pharyngeal pouch adherens junction organization process quality, abnormal WT + MO1-alcama standard conditions Fig. 5 with image from Choe et al., 2013
retinal ganglion cell layer morphology, abnormal WT + MO1-alcama + MO1-tp53 standard conditions Fig. 4 from Diekmann et al., 2009
retinal ganglion cell decreased amount, abnormal WT + MO1-alcama + MO1-tp53 standard conditions Fig. 4Fig. 6 from Diekmann et al., 2009
retina morphogenesis in camera-type eye disrupted, abnormal WT + MO1-alcama + MO1-tp53 standard conditions Fig. 6 from Diekmann et al., 2009
whole organism decreased size, abnormal WT + MO1-alcama + MO1-tp53 standard conditions Fig. 3 from Diekmann et al., 2009
retinal inner nuclear layer neuron decreased amount, abnormal WT + MO1-alcama + MO1-tp53 standard conditions Fig. 4 from Diekmann et al., 2009
neuron differentiation arrested, abnormal WT + MO1-alcama + MO1-tp53 standard conditions Fig. 6 from Diekmann et al., 2009
eye mislocalised ventrally, abnormal WT + MO1-alcama + MO1-tp53 standard conditions Fig. 3 from Diekmann et al., 2009
eye decreased size, abnormal WT + MO1-alcama + MO1-tp53 standard conditions Fig. 3Fig. 4Fig. S2 from Diekmann et al., 2009
cranial nerve II aplastic, abnormal WT + MO1-alcama + MO1-tp53 standard conditions Fig. 5 from Diekmann et al., 2009
neuron differentiation decreased rate, abnormal WT + MO1-alcama + MO1-tp53 standard conditions Fig. 6 from Diekmann et al., 2009
integument melanocyte decreased contractility, abnormal WT + MO1-alcama + MO1-tp53 high light intensity Fig. 3 from Diekmann et al., 2009
cranial nerve II decreased thickness, abnormal WT + MO1-alcama + MO1-tp53 standard conditions Fig. 5 from Diekmann et al., 2009
ventral mandibular arch decreased size, abnormal WT + MO1-alcama + MO1-tp53 standard conditions Fig. 3 from Diekmann et al., 2009
integument melanocyte spatial pattern, abnormal WT + MO1-alcama + MO1-tp53 high light intensity Fig. 3 from Diekmann et al., 2009
retinal neural layer nucleus apoptotic, abnormal WT + MO1-alcama + MO1-tp53 standard conditions Fig. 4 from Diekmann et al., 2009
optic nerve head axon absent, abnormal WT + MO1-alcama + MO1-tp53 standard conditions Fig. 4 from Diekmann et al., 2009
optic nerve head decreased size, abnormal WT + MO1-alcama + MO1-tp53 standard conditions Fig. 4 from Diekmann et al., 2009
eye decreased diameter, abnormal WT + MO1-alcama + MO1-tp53 standard conditions Fig. 4 from Diekmann et al., 2009
pericardial cavity increased size, abnormal WT + MO1-alcama + MO1-tp53 standard conditions Fig. 3 from Diekmann et al., 2009
retinal rod cell differentiation delayed, abnormal s356tTg + MO1-alcama + MO1-tp53 standard conditions Fig. 7 from Diekmann et al., 2009
cranial nerve II aplastic, abnormal s356tTg + MO1-alcama + MO1-tp53 standard conditions Fig. 7 from Diekmann et al., 2009
retinal rod cell differentiation process quality, abnormal s356tTg + MO1-alcama + MO1-tp53 standard conditions Fig. 7 from Diekmann et al., 2009
retinal ganglion cell decreased amount, abnormal s356tTg + MO1-alcama + MO1-tp53 standard conditions Fig. 7 from Diekmann et al., 2009
neuron differentiation arrested, abnormal s356tTg + MO1-alcama + MO1-tp53 standard conditions Fig. 7 from Diekmann et al., 2009
amacrine cell decreased amount, abnormal s356tTg + MO1-alcama + MO1-tp53 standard conditions Fig. 7 from Diekmann et al., 2009
cranial nerve II decreased thickness, abnormal s356tTg + MO1-alcama + MO1-tp53 standard conditions Fig. 7 from Diekmann et al., 2009
retina morphogenesis in camera-type eye disrupted, abnormal s356tTg + MO1-alcama + MO1-tp53 standard conditions Fig. 7 from Diekmann et al., 2009
pharyngeal pouch adherens junction organization process quality, abnormal ctnna1ct3aGt + MO1-alcama standard conditions Fig. 5 with image from Choe et al., 2013
Citations