ZFIN ID: ZDB-MRPHLNO-090826-8
Morpholino Name: MO3-emx2
Target: emx2 (1)
Sequence:
5' - GTAAACACATTCTTACCTGAGTTTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: This splice-blocking morpholino targets the exon 2/intron 2 boundary of emx2.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-emx2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-emx2 No data available
PHENOTYPE 
Phenotype resulting from MO3-emx2
No data available

Phenotype of all Fish created by or utilizing MO3-emx2
No data available
OTHER MO3-emx2 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)