header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-090730-2
Morpholino Name: MO4-tbx16
Target: tbx16 (1)
Sequence:
5' - AAGACAAGTACTCACCTCTGATAGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking morpholino targets the exon 1 donor splice site.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO4-tbx16 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO4-tbx16
Expressed Gene Anatomy Figures
aldh1a2 Fig. 6 with image from Wingert et al., 2011
clcnk Fig. 6 with image from Wingert et al., 2011
gata3 Fig. 6 with image from Wingert et al., 2011
hnf4a Fig. 6 with image from Wingert et al., 2011
irx3b Fig. 6 with image from Wingert et al., 2011
mecom Fig. 6 with image from Wingert et al., 2011
myb Fig. 4 from Burns et al., 2009
runx1 Fig. 4 from Burns et al., 2009
slc4a4a Fig. 6 with image from Wingert et al., 2011
slc12a1 Fig. 6 with image from Wingert et al., 2011
slc12a3 Fig. 6 with image from Wingert et al., 2011
slc20a1a Fig. 6 with image from Wingert et al., 2011
trpm7 Fig. 6 with image from Wingert et al., 2011
wt1b Fig. 6 with image from Wingert et al., 2011
PHENOTYPE
Phenotype resulting from MO4-tbx16
Phenotype of all Fish created by or utilizing MO4-tbx16
OTHER MO4-tbx16 MORPHOLINO PAGESNo links to external sites
CITATIONS (2)