Morpholino

MO1-grk3

ID
ZDB-MRPHLNO-090730-1
Name
MO1-grk3
Previous Names
  • MO1-adrbk2
  • zGRK2/3 ATG MO
Target
Sequence
5' - AGGTCCGCCATCTTCGCCCTCTGGG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-grk3
Expressed Gene Anatomy Figures
cdh5 Fig. 6 from Philipp et al., 2014
dmrt2a Fig. 2 from Philipp et al., 2008
efnb2a Fig. 6 from Philipp et al., 2014
flt4 Fig. 6 from Philipp et al., 2014
fn1a Fig. 7 from Burczyk et al., 2015
itga11a Fig. 7 from Burczyk et al., 2015
itgav Fig. 7 from Burczyk et al., 2015
itgb1a Fig. 7 from Burczyk et al., 2015
itgb1b Fig. 7 from Burczyk et al., 2015
myh6 Fig. 1 from Philipp et al., 2014
myh7 Fig. 1,  Fig. 9 from Philipp et al., 2014
myl7 Fig. 7 from Burczyk et al., 2015
Fig. 1,  Fig. 9 from Philipp et al., 2014
myod1 Fig. 4 from Philipp et al., 2008
nkx2.2a Fig. 8 from Evron et al., 2011
Fig. 5,  Fig. 7 from Philipp et al., 2008
nkx2.5 Fig. 9 from Philipp et al., 2014
prox1a Fig. 4,  Fig. 6 from Philipp et al., 2008
ptch2 Fig. 2,  Fig. 6 from Philipp et al., 2008
shha Fig. 7 from Philipp et al., 2008
smo Fig. 7 from Philipp et al., 2008
wnt11f2 Fig. 2 from Philipp et al., 2008
Phenotype
Phenotype resulting from MO1-grk3
Phenotype Fish Figures
atrium dilated, abnormal WT + MO1-grk3 Fig. 1 from Philipp et al., 2014
cardiac ventricle decreased size, abnormal WT + MO1-grk3 Fig. 1,  Fig. 8 from Philipp et al., 2014
cell proliferation involved in heart morphogenesis decreased occurrence, abnormal twu34Tg + MO1-grk3 Fig. 8 from Philipp et al., 2014
head decreased size, abnormal WT + MO1-grk3 Fig. 1 from Philipp et al., 2008
heart contraction decreased rate, abnormal WT + MO1-grk3 Fig. 1,  Fig. 10 from Philipp et al., 2014
heart contraction increased rate, abnormal WT + MO1-grk3 Fig. 1 from Philipp et al., 2014
heart development disrupted, abnormal WT + MO1-grk3 Fig. 8 from Philipp et al., 2014
heart primordium decreased size, abnormal WT + MO1-grk3 Fig. 9 from Philipp et al., 2014
muscle pioneer decreased amount, abnormal WT + MO1-grk3 Fig. 7 from Evron et al., 2011
pericardium edematous, abnormal WT + MO1-grk3 Fig. 1,  Fig. 10,  Fig. 11 from Philipp et al., 2014
regulation of heart contraction disrupted, abnormal WT + MO1-grk3 Fig. 1,  Fig. 10 from Philipp et al., 2014
slow muscle cell nucleus decreased amount, abnormal WT + MO1-grk3 Fig. 4,  Fig. 6 from Philipp et al., 2008
somite U-shaped, abnormal WT + MO1-grk3 Fig. 1,  Fig. 3 from Philipp et al., 2008
somite muscle pioneer decreased amount, abnormal WT + MO1-grk3 Fig. 4,  Fig. 6 from Philipp et al., 2008
whole organism decreased length, abnormal WT + MO1-grk3 Fig. 1 from Philipp et al., 2008
Phenotype of all Fish created by or utilizing MO1-grk3
Phenotype Fish Conditions Figures
heart development disrupted, abnormal WT + MO1-grk3 standard conditions Fig. 8 from Philipp et al., 2014
somite U-shaped, abnormal WT + MO1-grk3 standard conditions Fig. 1,  Fig. 3 from Philipp et al., 2008
regulation of heart contraction disrupted, abnormal WT + MO1-grk3 standard conditions Fig. 1,  Fig. 10 from Philipp et al., 2014
heart contraction increased rate, abnormal WT + MO1-grk3 standard conditions Fig. 1 from Philipp et al., 2014
head decreased size, abnormal WT + MO1-grk3 standard conditions Fig. 1 from Philipp et al., 2008
somite muscle pioneer decreased amount, abnormal WT + MO1-grk3 standard conditions Fig. 4,  Fig. 6 from Philipp et al., 2008
heart contraction decreased rate, abnormal WT + MO1-grk3 standard conditions Fig. 1,  Fig. 10 from Philipp et al., 2014
whole organism decreased length, abnormal WT + MO1-grk3 standard conditions Fig. 1 from Philipp et al., 2008
atrium dilated, abnormal WT + MO1-grk3 standard conditions Fig. 1 from Philipp et al., 2014
heart primordium decreased size, abnormal WT + MO1-grk3 standard conditions Fig. 9 from Philipp et al., 2014
slow muscle cell nucleus decreased amount, abnormal WT + MO1-grk3 standard conditions Fig. 4,  Fig. 6 from Philipp et al., 2008
muscle pioneer decreased amount, abnormal WT + MO1-grk3 standard conditions Fig. 7 from Evron et al., 2011
cardiac ventricle decreased size, abnormal WT + MO1-grk3 standard conditions Fig. 1,  Fig. 8 from Philipp et al., 2014
pericardium edematous, abnormal WT + MO1-grk3 standard conditions Fig. 1,  Fig. 10,  Fig. 11 from Philipp et al., 2014
cell proliferation involved in heart morphogenesis decreased occurrence, abnormal twu34Tg + MO1-grk3 standard conditions Fig. 8 from Philipp et al., 2014
muscle pioneer decreased amount, abnormal WT + MO1-gas8 + MO1-grk3 standard conditions Fig. 7 from Evron et al., 2011
somite muscle pioneer decreased amount, abnormal WT + MO1-grk3 + MO1-shha standard conditions Fig. 6 from Philipp et al., 2008
slow muscle cell nucleus decreased amount, abnormal WT + MO1-grk3 + MO1-shha standard conditions Fig. 6 from Philipp et al., 2008
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.