ZFIN ID: ZDB-MRPHLNO-090609-4
Morpholino Name: MO2-bmpr1ab
Target: bmpr1ab (1)
Previous Name: alk3b MO1 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GTCGAGTTGTTGAACTGTATGGCTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-bmpr1ab No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-bmpr1ab No data available
PHENOTYPE
Phenotype resulting from MO2-bmpr1ab
No data available

Phenotype of all Fish created by or utilizing MO2-bmpr1ab
Genome Resources:
CITATIONS (5)