header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-090515-1
Morpholino Name: MO1-cacna1da
Target: cacna1da (1)
Sequence:
5' - GCGTCCACCTGCATGGGCCTGCCAG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-cacna1da No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-cacna1da No data available
PHENOTYPE
Phenotype resulting from MO1-cacna1da
No data available

Phenotype of all Fish created by or utilizing MO1-cacna1da
No data available
OTHER MO1-cacna1da MORPHOLINO PAGESNo links to external sites
CITATIONS (1)