header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-090417-1
Morpholino Name: MO5-cyp26b1
Target: cyp26b1 (1)
Previous Name: Cyp26b1-SDEx3 MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - AGCTATTGACATTTTACCTTTCTGT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: targeted to splice-donor junction between exon 3 and intron 3
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO5-cyp26b1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO5-cyp26b1 No data available
PHENOTYPE
Phenotype resulting from MO5-cyp26b1
Phenotype of all Fish created by or utilizing MO5-cyp26b1
OTHER MO5-cyp26b1 MORPHOLINO PAGES No links to external sites
CITATIONS (2)