ZFIN ID: ZDB-MRPHLNO-090212-4
Morpholino Name: MO2-rlbp1a
Target: rlbp1a (1)
Previous Name: rlbp1b start blocking MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CGAAAACTTCCAGTAGCAGCCATAG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-rlbp1a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-rlbp1a
Expressed Gene Anatomy Figures
rlbp1a Fig. 4 from Collery et al., 2008
PHENOTYPE
Phenotype resulting from MO2-rlbp1a
Phenotype Figures
optokinetic behavior decreased occurrence, abnormal Fig. 5 from Collery et al., 2008

Phenotype of all Fish created by or utilizing MO2-rlbp1a
Phenotype Fish Conditions Figures
optokinetic behavior decreased occurrence, abnormal TU + MO2-rlbp1a standard conditions Fig. 5 from Collery et al., 2008
OTHER MO2-rlbp1a MORPHOLINO PAGESNo links to external sites
CITATIONS (1)