Morpholino

MO1-lmo7b

ID

ZDB-MRPHLNO-090210-1

Name

MO1-lmo7b

Previous Names

Target

Sequence

5' - CGCCACTCCAATCACACCTGCAAGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Target sequence is in 5' UTR of lmo7b.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-lmo7b

Expressed Gene	Anatomy	Figures
myl7	heart primitive heart tube	Fig. 9 from Ott et al., 2008
notch1b	(not) heart (not) heart tube	Fig. S2 from Ott et al., 2008

Phenotype

Phenotype resulting from MO1-lmo7b

Phenotype	Fish	Figures
cardiac ventricle mislocalised, abnormal	WT + MO1-lmo7b	Fig. 9 , text only from Ott et al., 2008
embryo development delayed, abnormal	WT + MO1-lmo7b	Fig. 8 , Fig. S1 from Ott et al., 2008
head morphology, abnormal	WT + MO1-lmo7b	Fig. 8 , Fig. S1 from Ott et al., 2008
head development disrupted, abnormal	WT + MO1-lmo7b	Fig. 8 , Fig. S1 from Ott et al., 2008
heart morphology, abnormal	WT + MO1-lmo7b	Fig. 8 , Fig. 9 , Fig. S2 from Ott et al., 2008
heart contraction decreased rate, abnormal	WT + MO1-lmo7b	text only from Ott et al., 2008
heart development disrupted, abnormal	WT + MO1-lmo7b	Fig. 9 , Fig. S2 from Ott et al., 2008
heart looping disrupted, abnormal	WT + MO1-lmo7b	Fig. 9 , text only from Ott et al., 2008
pericardium increased size, abnormal	WT + MO1-lmo7b	Fig. 8 from Ott et al., 2008
post-anal tail morphogenesis disrupted, abnormal	WT + MO1-lmo7b	Fig. 8 , Fig. S1 from Ott et al., 2008
post-vent region curved ventral, abnormal	WT + MO1-lmo7b	Fig. 8 , Fig. S1 from Ott et al., 2008
post-vent region morphology, abnormal	WT + MO1-lmo7b	Fig. 8 , Fig. S1 from Ott et al., 2008
whole organism decreased length, abnormal	WT + MO1-lmo7b	Fig. 8 , Fig. S1 from Ott et al., 2008

Phenotype of all Fish created by or utilizing MO1-lmo7b

Phenotype	Fish	Conditions	Figures
heart looping disrupted, abnormal	WT + MO1-lmo7b	standard conditions	Fig. 9 , text only from Ott et al., 2008
heart morphology, abnormal	WT + MO1-lmo7b	standard conditions	Fig. 8 , Fig. 9 , Fig. S2 from Ott et al., 2008
heart development disrupted, abnormal	WT + MO1-lmo7b	standard conditions	Fig. 9 , Fig. S2 from Ott et al., 2008
post-vent region curved ventral, abnormal	WT + MO1-lmo7b	standard conditions	Fig. 8 , Fig. S1 from Ott et al., 2008
head morphology, abnormal	WT + MO1-lmo7b	standard conditions	Fig. 8 , Fig. S1 from Ott et al., 2008
head development disrupted, abnormal	WT + MO1-lmo7b	standard conditions	Fig. 8 , Fig. S1 from Ott et al., 2008
post-anal tail morphogenesis disrupted, abnormal	WT + MO1-lmo7b	standard conditions	Fig. 8 , Fig. S1 from Ott et al., 2008
embryo development delayed, abnormal	WT + MO1-lmo7b	standard conditions	Fig. 8 , Fig. S1 from Ott et al., 2008
heart contraction decreased rate, abnormal	WT + MO1-lmo7b	standard conditions	text only from Ott et al., 2008
cardiac ventricle mislocalised, abnormal	WT + MO1-lmo7b	standard conditions	Fig. 9 , text only from Ott et al., 2008
pericardium increased size, abnormal	WT + MO1-lmo7b	standard conditions	Fig. 8 from Ott et al., 2008
whole organism decreased length, abnormal	WT + MO1-lmo7b	standard conditions	Fig. 8 , Fig. S1 from Ott et al., 2008
post-vent region morphology, abnormal	WT + MO1-lmo7b	standard conditions	Fig. 8 , Fig. S1 from Ott et al., 2008

Citations