ZFIN ID: ZDB-MRPHLNO-090201-1
Morpholino Name: MO2-mmp13a
Target: mmp13a (1)
Previous Name: MO2-mmp13 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - AAGCAGGTCTTCATGTTTCTCGTGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-mmp13a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-mmp13a No data available
PHENOTYPE
Phenotype resulting from MO2-mmp13a
Phenotype of all Fish created by or utilizing MO2-mmp13a
Genome Resources:
CITATIONS (3)